After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
RSV RSV-G Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:897bp
Description du ADNc:Full length Clone DNA of Human RSV (subtype A, strain Long) glycoprotein G / RSV-G with C terminal HA tag.
Synonyme du gène:G, HRSVgp07
Espèces:RSV
Vecteur:pCMV3-C-HA
Plasmid:pCMV3-RSV-G(A-long)-HA
Site de restriction:KpnI + XbaI (6kb + 0.94kb)
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P20895.2.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
RSV RSV-G Gene Plasmid Map
Human respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA Marqueur on other vectors
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40041-ACGCHF390
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40041-ACRCHF390
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG40041-CFCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG40041-CHCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG40041-CMCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG40041-CYCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40041-GCHF110
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG40041-NFCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG40041-NHCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40041-NMCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG40041-NYCHF350
Humain respiratory syncytial virus (RSV) (subtype A, strain Long) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40041-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

Références
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Size / Price
    Catalogue : VG40041-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »