Commande rapide

Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur

  • Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag
  • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
Fiche techniqueCommentairesProduits apparentésProtocoles
RSV RSV-F Informations sur les produits clonés de cDNA
Taille du ADNc:1725bp
Description du ADNc:Full length Clone DNA of Human RSV (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F with N terminal His tag.
Synonyme du gène:F, HRSVgp08
Site de restriction:KpnI + XbaI (6kb + 1.74kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P11209.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
RSV RSV-F Gene Plasmid Map
Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag
Immunochemical staining of human CCNF in human brain with rabbit polyclonal antibody (1 µg/mL, formalin-fixed paraffin embedded sections).
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur on other vectors
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40037-ACGCHF410
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40037-ACRCHF410
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG40037-CFCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG40037-CHCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG40037-CMCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG40037-CYCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-GCHF140
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG40037-NFCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG40037-NHCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40037-NMCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG40037-NYCHF380
Humain respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Catalogue : VG40037-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.