After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain CD122 / IL-2RB expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL2RB/CD122 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000878.2
Taille du ADNc:1656bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 2 receptor, beta.
Synonyme du gène:IL2RB, CD122, P70-75
Espèces:Human
Vecteur:pCMV/hygro
Plasmid:pCMV-IL2RB
Site de restriction:KpnI + XbaI (5.5kb + 1.66kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL2RB/CD122 Gene Plasmid Map
Human IL2Rb / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Fond

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

Références
  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • Size / Price
    Catalogue : HG10696-M-N
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human IL2Rb / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »