Commande rapide

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain IL6 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:
Description du ADNc:
Synonyme du gène:
Espèces:
Vecteur:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Shipping_carrier:
Stockage:
Humain IL6 Gene Plasmid Map
Human IL6 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Références
  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.
  • Datasheet & Documentation

    Contact Us
      Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »