Commande rapide

Text Size:AAA

Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
H12N5 HA Informations sur les produits clonés de cDNA
Taille du ADNc:1695bp
Description du ADNc:Full length Clone DNA of Influenza A H12N5 (A/green-winged teal/ALB/199/1991) HA with N terminal His tag.
Synonyme du gène:HA1, Hemagglutinin
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB88110.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11718-ACGCHF410
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11718-ACRCHF410
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-CCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11718-CFCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11718-CHCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11718-CMCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11718-CYCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11718-NFCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11718-NHCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11718-NMCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11718-NYCHF380
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG11718-NH
Prix catalogue :   (Save )
Prix :      [How to order]
Disponibilité2-3 weeksInstructions d’expédition
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.