Commande rapide

Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
H4N4 HA Informations sur les produits clonés de cDNA
Taille du ADNc:1695bp
Description du ADNc:Full length Clone DNA of Influenza A H4N4 (mallard duck/Alberta/299/1977) Hemagglutinin with N terminal His tag.
Synonyme du gène:Hemagglutinin, HA
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB87495.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur on other vectors
Grippe A H4N4 (A/mallard duck/Alberta/299/1977) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40008-ACGCHF410
Grippe A H4N4 (A/mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40008-ACRCHF410
Grippe A H4N4 (A/mallard duck/Alberta/299/1977) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40008-CCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG40008-CFCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG40008-CHCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG40008-CMCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG40008-CYCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG40008-NFCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG40008-NHCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40008-NMCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG40008-NYCHF380
Grippe A H4N4 (mallard duck/Alberta/299/1977) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40008-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40008-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.