Commande rapide

Text Size:AAA

Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
H4N4 NA Informations sur les produits clonés de cDNA
Taille du ADNc:1413bp
Description du ADNc:Full length Clone DNA of Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase with N terminal His tag.
Synonyme du gène:Neuraminidase, NA
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, N-His Marqueur on other vectors
Grippe A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40234-ACGCHF390
Grippe A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40234-ACRCHF390
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, C-Flag MarqueurVG40234-CFCHF350
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, C-His MarqueurVG40234-CHCHF350
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, C-Myc MarqueurVG40234-CMCHF350
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, C-HA MarqueurVG40234-CYCHF350
Grippe A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid (Codon Optimized)VG40234-GCHF110
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, N-Flag MarqueurVG40234-NFCHF350
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, N-His MarqueurVG40234-NHCHF350
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, N-Myc MarqueurVG40234-NMCHF350
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) ORF mammalian expression plasmid, N-HA MarqueurVG40234-NYCHF350
Grippe A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase (NA) natural ORF mammalian expression plasmidVG40234-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Size / Price
    Catalogue : VG40234-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.