After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

Fiche techniqueCommentairesProduits apparentésProtocoles
H4N8 HA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:1695bp
Description du ADNc:Full length Clone DNA of Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin with C terminal HA tag.
Synonyme du gène:Hemagglutinin, HA
Espèces:H4N8
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P19695.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag on other vectors
Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40025-ACGCHF410
Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40025-ACRCHF410
Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40025-CCHF470
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40025-CFCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40025-CHCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40025-CMCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40025-CYCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40025-NFCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40025-NHCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40025-NMCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40025-NYCHF380
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40025-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »