After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His Marqueur, expression ready

Fiche techniqueCommentairesProduits apparentésProtocoles
H5N1 HA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:1725bp
Description du ADNc:Full length Clone DNA of Influenza A H5N1 (A/Duck/Hong Kong/p46/97) HA with N terminal His tag.
Synonyme du gène:HA1, Hemagglutinin
Espèces:H5N1
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAF02306.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His Marqueur, expression ready on other vectors
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark Marqueur, expression readyVG40001-ACGCHF414
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40001-ACRCHF414
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmidVG40001-CCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag Marqueur, expression readyVG40001-CFCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-His Marqueur, expression readyVG40001-CHCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Myc Marqueur, expression readyVG40001-CMCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-HA Marqueur, expression readyVG40001-CYCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Flag MarqueurVG40001-NFCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His Marqueur, expression readyVG40001-NHCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Myc Marqueur, expression readyVG40001-NMCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-HA Marqueur, expression readyVG40001-NYCHF378
Grippe A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40001-UTCHF378
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40001-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »