Commande rapide

Text Size:AAA

Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His Marqueur, expression ready

Fiche techniqueCommentairesProduits apparentésProtocoles
H5N1 HA Informations sur les produits clonés de cDNA
Taille du ADNc:1701bp
Description du ADNc:Full length Clone DNA of Influenza A H5N1 (A/Xinjiang/1/2006) HA with N terminal His tag.
Synonyme du gène:HA1, Hemagglutinin
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACJ68614.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His Marqueur, expression ready on other vectors
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark Marqueur, expression readyVG40004-ACGCHF414
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40004-ACRCHF414
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmidVG40004-CCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Flag Marqueur, expression readyVG40004-CFCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-His Marqueur, expression readyVG40004-CHCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Myc Marqueur, expression readyVG40004-CMCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-HA Marqueur, expression readyVG40004-CYCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Flag Marqueur, expression readyVG40004-NFCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His Marqueur, expression readyVG40004-NHCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Myc Marqueur, expression readyVG40004-NMCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-HA Marqueur, expression readyVG40004-NYCHF378
Grippe A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40004-UTCHF378
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40004-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.