After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
H5N1 HA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:1707bp
Description du ADNc:Full length Clone DNA of Influenza A H5N1 (Egypt/3300-NAMRU3/2008) Hemagglutinin with N terminal His tag.
Synonyme du gène:Hemagglutinin, HA
Espèces:H5N1
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACI06185.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur on other vectors
Grippe A H5N1 (A/Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40049-ACGCHF410
Grippe A H5N1 (A/Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40049-ACRCHF410
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG40049-CFCHF380
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG40049-CHCHF380
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG40049-CMCHF380
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG40049-CYCHF380
Grippe A H5N1 (A/Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40049-GCHF140
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG40049-NFCHF380
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG40049-NHCHF380
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40049-NMCHF380
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG40049-NYCHF380
Grippe A H5N1 (Egypt/3300-NAMRU3/2008) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40049-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Références
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catalogue : VG40049-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »