After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
H5N1 HA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:1695bp
Description du ADNc:Full length Clone DNA of Influenza A H5N1 (A/bar-headed goose/Qinghai/1A/2005) Hemagglutinin with C terminal HA tag.
Synonyme du gène:Hemagglutinin, HA
Espèces:H5N1
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABF93441.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Marqueur on other vectors
Grippe A H5N1 (A/bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40117-ACGCHF410
Grippe A H5N1 (A/bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40117-ACRCHF410
Grippe A H5N1 (A/bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40117-CCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG40117-CFCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG40117-CHCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG40117-CMCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG40117-CYCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG40117-NFCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG40117-NHCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40117-NMCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG40117-NYCHF380
Grippe A H5N1 (bar-headed goose/Qinghai/1A/2005) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40117-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Références
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catalogue : VG40117-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »