Commande rapide

Text Size:AAA

Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
H5N1 HA Informations sur les produits clonés de cDNA
Taille du ADNc:1704bp
Description du ADNc:Full length Clone DNA of Influenza A H5N1 (chicken/Yamaguchi/7/2004) Hemagglutinin with C terminal HA tag.
Synonyme du gène:Hemagglutinin, HA
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with BAD89305.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Marqueur on other vectors
Grippe A H5N1 (A/chicken/Yamaguchi/7/2004) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40088-ACGCHF414
Grippe A H5N1 (A/chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40088-ACRCHF414
Grippe A H5N1 (A/chicken/Yamaguchi/7/2004) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40088-CCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG40088-CFCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG40088-CHCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG40088-CMCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG40088-CYCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG40088-NFCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG40088-NHCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40088-NMCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG40088-NYCHF378
Grippe A H5N1 (chicken/Yamaguchi/7/2004) Hémagglutinine(HA) ORF mammalian expression plasmid (Codon Optimized)VG40088-UTCHF378
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40088-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.