After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:1113
cDNA Description:ORF Clone of Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin DNA.
Gene Synonym:Hemagglutinin, HA
Species:H5N8
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone) on other vectors
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-CF295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-CH295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-CM295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-CY295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-G95
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-NF295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-NH295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-NM295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-NY295
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40389-UT295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Catalog:VG40389-CH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"