Commande rapide

Text Size:AAA

Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
H5N8 HA Informations sur les produits clonés de cDNA
Taille du ADNc:1717bp
Description du ADNc:Full length Clone DNA of Influenza A H5N8 (A/duck/NY/191255-59/02) HA with N terminal His tag.
Synonyme du gène:HA1, Hemagglutinin
Site de restriction:KpnI + XbaI (6kb + 1.74kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAP72011.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
H5N8 HA Gene Plasmid Map
Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Marqueur on other vectors
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11717-ACGCHF410
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG11717-ACRCHF410
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11717-CCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag MarqueurVG11717-CFCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His MarqueurVG11717-CHCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc MarqueurVG11717-CMCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA MarqueurVG11717-CYCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag MarqueurVG11717-NFCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His MarqueurVG11717-NHCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11717-NMCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA MarqueurVG11717-NYCHF380
Grippe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11717-UTCHF380
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catalogue : VG11717-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.