After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris TNFSF14/LIGHT/CD258 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse LIGHT/TNFSF14 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:
Description du ADNc:
Synonyme du gène:
Espèces:Mouse
Vecteur:
Site de restriction:
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
Stockage:
Mouse LIGHT/TNFSF14 Gene Plasmid Map
Mouse LIGHT / TNFSF14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Fond

LIGHT, also known as TNFSF14 or CD258, is a newly identified member of the TNF superfamily (TNFSF14) that is expressed by activated T lymphocytes, monocytes, granulocytes, spleen cells, and immature dendritic cells. TNFSF14 / LIGHT / CD258 is a type II transmembrane protein that is known to bind 2 membrane-bound TNFSF signaling receptors: HVEM, which is predominantly expressed by T cells, and lymphotoxin β receptor (LTβR), which is expressed by stromal cells and nonlymphoid hematopoietic cells. TNFSF14 / LIGHT / CD258 also binds to a soluble nonsignaling receptor, decoy receptor 3 (DcR3), which can modulate the function of LIGHT in vivo. TNFSF14 / LIGHT / CD258 can also costimulate T cell responses via HVEM, which is constitutively expressed in most lymphocyte subpopulations, including CD4+ and CD8+ T cells. In addition, TNFSF14 / LIGHT / CD258 has been shown to suppress tumor formation in vivo and to induce tumor cell apoptosis via the up-regulation of intercellular adhesion molecule 1 and an increased lymphocyte adhesion to cancer cells. Thus, TNFSF14 / LIGHT / CD258 is being actively investigated as a possible basis for cancer treatment.

Références
  • Ogawa T, et al. (2010) CXCR3 binding chemokine and TNFSF14 over expression in bladder urothelium of patients with ulcerative interstitial cystitis. J Urol. 183(3): 1206-12.
  • Kanodia S, et al. (2010) Expression of LIGHT/TNFSF14 combined with vaccination against human papillomavirus Type 16 E7 induces significant tumor regression. Cancer Res. 70(10): 3955-64.
  • Hosokawa Y, et al. (2010) TNFSF14 coordinately enhances CXCL10 and CXCL11 productions from IFN-gamma-stimulated human gingival fibroblasts. Mol Immunol. 47(4): 666-70.
  • Contact Us
    Images
    • Mouse LIGHT / TNFSF14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »