Commande rapide

MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA Marqueur

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
Fiche techniqueCommentairesProduits apparentésProtocoles
MERS-CoV CoV-orf4a Informations sur les produits clonés de cDNA
Gene_bank_ref_id:JX869059.2
Taille du ADNc:372 bp
Description du ADNc:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4a with C terminal HA tag.
Synonyme du gène:CoV-orf4a
Espèces:MERS-CoV
Vecteur:pCMV3-C-HA
Plasmid:pCMV3-NS3B-HA
Site de restriction:KpnI + XbaI(6kb+0.37kb)
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:Identical with the Gene Bank AFS88938 sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA Marqueur on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40083-ACGCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40083-ACRCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40083-ANGCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40083-ANRCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Flag MarqueurVG40083-CFCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-His MarqueurVG40083-CHCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Myc MarqueurVG40083-CMCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA MarqueurVG40083-CYCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid (Codon Optimized)VG40083-GCHF110
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Flag MarqueurVG40083-NFCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His MarqueurVG40083-NHCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Myc MarqueurVG40083-NMCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-HA MarqueurVG40083-NYCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a natural ORF mammalian expression plasmidVG40083-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40083-CY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »