Commande rapide

Text Size:AAA

MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
MERS-CoV CoV-orf4a Informations sur les produits clonés de cDNA
Taille du ADNc:330bp
Description du ADNc:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4a with N terminal His tag.
Synonyme du gène:CoV-orf4a
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank AFS88938 sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His Marqueur on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40083-ACGCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40083-ACRCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40083-ANGCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40083-ANRCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Flag MarqueurVG40083-CFCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-His MarqueurVG40083-CHCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Myc MarqueurVG40083-CMCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA MarqueurVG40083-CYCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid (Codon Optimized)VG40083-GCHF110
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Flag MarqueurVG40083-NFCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His MarqueurVG40083-NHCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Myc MarqueurVG40083-NMCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-HA MarqueurVG40083-NYCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4a natural ORF mammalian expression plasmidVG40083-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40083-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.