After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
MERS-CoV CoV-orf4b Informations sur les produits clonés de cDNA
Gene_bank_ref_id:JX869059.2
Taille du ADNc:741bp
Description du ADNc:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with N terminal His tag.
Synonyme du gène:CoV-orf4b
Espèces:MERS-CoV
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank AFS88939.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His Marqueur on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-GFPSpark MarqueurVG40084-ACGCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-OFPSpark / RFP MarqueurVG40084-ACRCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-GFPSpark MarqueurVG40084-ANGCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-OFPSpark / RFP MarqueurVG40084-ANRCHF390
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Flag MarqueurVG40084-CFCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-His MarqueurVG40084-CHCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Myc MarqueurVG40084-CMCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA MarqueurVG40084-CYCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid (Codon Optimized)VG40084-GCHF110
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Flag MarqueurVG40084-NFCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His MarqueurVG40084-NHCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Myc MarqueurVG40084-NMCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-HA MarqueurVG40084-NYCHF350
MERS-CoV (NCoV / Novel coronavirus) orf4b natural ORF mammalian expression plasmidVG40084-UTCHF350
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : VG40084-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »