Commande rapide

Souris 2510003E04RIK expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris 2510003E04RIK Informations sur les produits clonés de cDNA
    Taille du ADNc:1854bp
    Description du ADNc:Full length Clone DNA of Mus musculus RIKEN cDNA 2510003E04 gene with N terminal His tag.
    Synonyme du gène:KBP, mKIAA1279, 0710007C18Rik
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    ( We provide with 2510003E04RIK qPCR primers for gene expression analysis, MP201841 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Souris 2510003E04RIK expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Product nameProduct name
    Size / Price
    Catalogue : MG51968-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.