Commande rapide

Text Size:AAA

Souris ABHD4 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ABHD4 Informations sur les produits clonés de cDNA
Taille du ADNc:957bp
Description du ADNc:Full length Clone DNA of Mus musculus abhydrolase domain containing 4 with N terminal His tag.
Synonyme du gène:Abh4, AI429574, 1110035H23Rik, Abhd4
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Abhydrolase domain containing 4 (ABHD4), also known as alpha/beta-hydrolase 4 (ABH4) , or lyso-N-acylphosphatidylethanolamine lipase, which belongs to the ABHD4/ABHD5 subfamily of peptidase S33 family. Abhydrolase domain containing (ABHD) gene was a small group belongs to alpha/beta hydrolase superfamily. Known members of this group are all found to be involved in important biochemical processes and related to various diseases. The alpha/beta-hydrolase 4 (ABH4) is a lysophospholipase/phospholipase B that selectively hydrolyzes N-acyl phosphatidylethanolamines (NAPEs) and lysoNAPEs. ABH4 accepts lysoNAPEs bearing both saturated and polyunsaturated N-acyl chains as substrates and displays a distribution that closely mirrors lysoNAPE-lipase activity in mouse tissues. The existence of an NAPE-PLD-independent route for NAE biosynthesis and suggest that ABH4 plays a role in this metabolic pathway by acting as a (lyso)NAPE-selective lipase.

  • Li F, et al. (2009) An unannotated alpha/beta hydrolase superfamily member, ABHD6 differentially expressed among cancer cell lines. Mol Biol Rep. 36(4): 691-6.
  • Simon G.M, et al. (2006) Endocannabinoid biosynthesis proceeding through glycerophospho-N-acyl ethanolamine and a role for alpha/beta hydrolase 4 in this pathway. J. Biol. Chem. 281: 26465-72.
  • Size / Price
    Catalogue : MG50747-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.