After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse AK4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001177602.1
Taille du ADNc:672bp
Description du ADNc:Full length Clone DNA of Mus musculus adenylate kinase 4 with N terminal Myc tag.
Synonyme du gène:Ak3, AK 4, Ak-3, Ak-4, Ak3l1, D4Ertd274e
Espèces:Mouse
Vecteur:pCMV3-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52601-ACGCHF270
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52601-ACRCHF270
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52601-ANGCHF270
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52601-ANRCHF270
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52601-CFCHF230
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52601-CHCHF230
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52601-CMCHF230
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52601-CYCHF230
Mouse AK4 Gene cDNA clone plasmidMG52601-GCHF90
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52601-NFCHF230
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52601-NHCHF230
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52601-NMCHF230
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52601-NYCHF230
Souris AK4 / Adenylate Kinase 4 / AK3L1 Gène ADNc clone le vecteur de clonageMG52601-UCHF90
Souris AK4 / Adenylate Kinase 4 / AK3L1 expression plasmide de Gène l'ADNc ORF cloneMG52601-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Catalogue : MG52601-NM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »