AKT1 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

AKT1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1443 bp
Description
Full length Clone DNA of Mouse thymoma viral proto-oncogene 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AKT1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

Akt cDNA ORF Clone, Mouse; PKB cDNA ORF Clone, Mouse; PKB/Akt cDNA ORF Clone, Mouse; PKBalpha cDNA ORF Clone, Mouse; Rac cDNA ORF Clone, Mouse

AKT1 Background Information

v-akt murine thymoma viral oncogene homolog 1 (AKT1), or protein kinase B-alpha (PKB-ALPHA) is a serine-threonine protein kinase, belonging to the Protein Kinase Superfamily. AKT1 is a major mediator of the responses to insulin, insulin-like growth factor 1 (IGF1), and glucose. AKT1 also plays a key role in the regulation of both muscle cell hypertrophy and atrophy. AKT1 activity is required for physiologic cardiac growth in response to IGF1 stimulation or exercise training. In contrast, AKT1 activity was found to antagonize pathologic cardiac growth that occurs in response to endothelin 1 stimulation or pressure overload. AKT1 selectively promotes physiological cardiac growth while AKT2 selectively promotes insulin-stimulated cardiac glucose metabolism. AKT1 deletion prevented tumor initiation as well as tumor progression, coincident with decreased Akt signaling in tumor tissues. AKT1 is the primary Akt isoform activated by mutant K-ras in lung tumors, and that AKT3 may oppose AKT1 in lung tumorigenesis and lung tumor progression. A number of separate studies have implicated AKT1 as an inhibitor of breast epithelial cell motility and invasion. AKT1 may have a dual role in tumorigenesis, acting not only pro-oncogenically by suppressing apoptosis but also anti-oncogenically by suppressing invasion and metastasis.
Full Name
v-akt murine thymoma viral oncogene homolog 1
Research Areas
References
  • Hollander MC, et al. (2011) Akt1 deletion prevents lung tumorigenesis by mutant K-ras. Oncogene. 30(15): 1812-21.
  • Devaney JM, et al. (2011) AKT1 polymorphisms are associated with risk for metabolic syndrome. Hum Genet. 129(2): 129-39.
  • Dillon RL, et al. (2010) Distinct biological roles for the akt family in mammary tumor progression. Cancer Res. 70(11): 4260-4.
  • Toker A, et al. (2006) Akt signaling and cancer: surviving but not moving on. Cancer Res. 66(8): 3963-6.
  • Muslin AJ, et al. (2006) Role of Akt in cardiac growth and metabolism. Novartis Found Symp. 274: 118-26.

AKT1 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait