Commande rapide

Text Size:AAA

Mouse ALDH1A1 ORF mammalian expression plasmid, C-Myc tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ALDH1A1 Informations sur les produits clonés de cDNA
Taille du ADNc:1506bp
Description du ADNc:Full length Clone DNA of Mus musculus aldehyde dehydrogenase family 1, subfamily A1 with C terminal Myc tag.
Synonyme du gène:E1; Ahd2; Ahd-2; Aldh1; Raldh1; Aldh1a2
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1 (RALDH1), is an enzyme that is expressed at high levels in stem cells and that has been suggested to regulate stem cell function. The retinaldehyde dehydrogenase (RALDH) subfamily of ALDHs, composed of ALDH1A1, ALDH1A2, ALDH1A3, and ALDH8A1, regulate development by catalyzing retinoic acid biosynthesis. The ALDH1A1 protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH1A1 also belongs to the group of corneal crystallins that help maintain the transparency of the cornea. Increased ALDH1A1 activity has been found in the stem cell populations of leukemia and some solid tumors. In tumor specimens, increased ALDH1A1 immunopositivity was found not only in secretory type cancer epithelial cells but also in neuroendocrine tumor populations. ALDH1 has been identified as a reliable marker of breast cancer stem cells. ALDH1 expression in primary cancer is an independent prognostic factor in node-positive breast cancer patients. ALDH1A1 plays a key role in normal hematopoiesis, and as a TLX1 transcriptional target, ALDH1A1 may contribute to the ability of this homeoprotein to alter cell fate and induce tumor growth.

  • Li T, et al. (2010). ALDH1A1 is a marker for malignant prostate stem cells and predictor of prostate cancer patients' outcome. Lab Invest. 90(2): 234-44.
  • Levi BP, et al. (2009) Aldehyde dehydrogenase 1a1 is dispensable for stem cell function in the mouse hematopoietic and nervous systems. Blood. 113(8): 1670-80.
  • Rahman FB, et al. (2006) Uncompetitive inhibition of Xenopus laevis aldehyde dehydrogenase 1A1 by divalent cations. Zoolog Sci. 23(3): 239-44.
  • Jester JV, et al. (1999). The cellular basis of corneal transparency: evidence for corneal crystallins. J Cell Sci. 112 ( Pt 5): 613-22.
  • Size / Price
    Catalogue : MG52886-CM
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.