After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ALOX5AP Informations sur les produits clonés de cDNA
Taille du ADNc:486bp
Description du ADNc:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with N terminal HA tag.
Synonyme du gène:Flap
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52815-ACGCHF270
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52815-ACRCHF270
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52815-ANGCHF270
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52815-ANRCHF270
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52815-CFCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52815-CHCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52815-CMCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52815-CYCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine Gène ADNc clone le vecteur de clonageMG52815-GCHF90
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52815-NFCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52815-NHCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52815-NMCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52815-NYCHF230
Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF cloneMG52815-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Catalogue : MG52815-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.