Commande rapide

Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris ALOX5AP Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_009663.1
    Taille du ADNc:486bp
    Description du ADNc:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with N terminal His tag.
    Synonyme du gène:Flap
    Espèces:Mouse
    Vecteur:pCMV3-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52815-ACGCHF270
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52815-ACRCHF270
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52815-ANGCHF270
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52815-ANRCHF270
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52815-CFCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52815-CHCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52815-CMCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52815-CYCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine Gène ADNc clone le vecteur de clonageMG52815-GCHF90
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52815-NFCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52815-NHCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52815-NMCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52815-NYCHF230
    Souris ALOX5AP / 5-lipoxygenase-activating Protéine expression plasmide de Gène l'ADNc ORF cloneMG52815-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

    Références
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Catalogue : MG52815-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »