After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris ApoE/Apolipoprotein E expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse APOE Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_009696.3
Taille du ADNc:936bp
Description du ADNc:Full length Clone DNA of Mus musculus apolipoprotein E with C terminal HA tag.
Synonyme du gène:AI255918
Espèces:Mouse
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid residues. There are three isoforms in human (apoE2, apoE3, and apoE4) due to different amino acid residues at positions 112 and 158. ApoE is synthesized predominantly in the liver, but also by cells in the spleen, brain, lung, kidney, ovary, adrenal, and muscle tissues. Hepatic parenchyma cells are the main apoE producing cells in mammalian body, probably accounting for two thirds to three fourths of the plasma apoE . In the nervous system, apoE mRNA is present in neurons, astrocytes, ependymal cells, nonmyelinating Schwann cells, but not in microglia, oligodendroglia, choroidal cells, or myelinating Schwann cells. ApoE produced by mammalian cells exists in different forms, monomers, dimers, modified, unmodified, lipid-rich, and lipid-poor, and so forth. ApoE plays a double-role in immune responses. Both apoE containing lipoproteins and multimers of synthetic apoE peptides inhibited proliferation of cultured lymphocytes by inhibiting DNA synthesis and reducing phospholipid turnover in T cells. ApoE can also affect innate and acquired immune responses in vitro by its ability to suppress stimulation of cultured neutrophils. ApoE can bind lipopolysaccharide (LPS), attenuate the inflammatory response, and thus reduce LPS induced lethality. Injection of LPS stimulated higher expression of inflammatory cytokines like interleukin (IL)-1β, IL-12, and interferon-γ (IFN-γ), as well as IL-6.

Références
  • Mahley RW. (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science. 240(4852): 622-30.
  • Aleshkov S, et al. (1989) Interaction of nascent apoe2, apoe3, and apoe4 isoforms expressed in mammalian cells with amyloid peptide. Relevance to Alzheimer's disease. Biochemistry. 36(34): 10571-80.
  • Hussain MM, et al. (1997) Synthesis, modification, and flotation properties of rat hepatocyte apolipoproteins. Biochimica et Biophysica Acta. 101(1): 90-101.
  • Size / Price
    Catalogue : MG51201-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »