ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51638-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ARF2/ADP-ribosylation factor 2 Reagents

CRO Services

Product recommended


All ARF2/ADP-ribosylation factor 2 Reagents

ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
585 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse ADP-ribosylation factor 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.59kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ARF2/ADP-ribosylation factor 2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609

ARF2/ADP-ribosylation factor 2 Background Information

Full Name
ADP-ribosylation factor 4

ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone in Cloning Vector, Rat RG80970-U
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, untagged RG80970-UT
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80970-ACG
ARF2/ADP-ribosylation factor 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80970-ACGLN
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80970-ACR
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80970-CF
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80970-NF
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-His tag RG80970-CH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-His tag RG80970-NH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-HA tag RG80970-CY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-HA tag RG80970-NY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, C-Myc tag RG80970-CM
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Rat, N-Myc tag RG80970-NM
ARF2/ADP-ribosylation factor 2 qPCR Primer Pairs, Rat RP300934

ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone in Cloning Vector, Mouse MG51638-G
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, untagged MG51638-UT
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51638-ACG
ARF2/ADP-ribosylation factor 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51638-ACGLN
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51638-ANG
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51638-ACR
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51638-ANR
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51638-NF
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-His tag MG51638-CH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-His tag MG51638-NH
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-HA tag MG51638-CY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-HA tag MG51638-NY
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, C-Myc tag MG51638-CM
ARF2/ADP-ribosylation factor 2 cDNA ORF Clone, Mouse, N-Myc tag MG51638-NM
ARF2/ADP-ribosylation factor 2 qPCR Primer Pairs, Mouse MP201511
info info
添加购物车成功! 添加购物车失败!