Commande rapide

Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ARF6 Informations sur les produits clonés de cDNA
Taille du ADNc:528bp
Description du ADNc:Full length Clone DNA of Mus musculus ADP-ribosylation factor 6 with N terminal His tag.
Synonyme du gène:AI788669, AW496366
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51972-ACGCHF270
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51972-ACRCHF270
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51972-ANGCHF270
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51972-ANRCHF270
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51972-CFCHF230
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51972-CHCHF230
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51972-CMCHF230
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51972-CYCHF230
Souris Arf6/ADP-ribosylation factor 6 Gène ADNc clone le vecteur de clonageMG51972-GCHF90
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51972-NFCHF230
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51972-NHCHF230
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51972-NMCHF230
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51972-NYCHF230
Souris Arf6/ADP-ribosylation factor 6 expression plasmide de Gène l'ADNc ORF cloneMG51972-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG51972-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.