ARPC1A cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

ARPC1A cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1113 bp
Description
Full length Clone DNA of Mouse actin related protein 2/3 complex, subunit 1A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ARPC1A cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

0610010H08Rik cDNA ORF Clone, Mouse; 1110030K07Rik cDNA ORF Clone, Mouse; 41kDa cDNA ORF Clone, Mouse; AA407347 cDNA ORF Clone, Mouse; Sid32 cDNA ORF Clone, Mouse; Sid329 cDNA ORF Clone, Mouse

ARPC1A Background Information

Full Name
actin related protein 2/3 complex, subunit 1A, 41kDa
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait