ART1 cDNA ORF Clone, Mouse, untagged

Cat: MG50988-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ART1 Reagents

CRO Services

Product recommended


All ART1 Reagents

ART1 cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
978 bp
Description
Full length Clone DNA of Mouse ADP-ribosyltransferase 1.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ART1 cDNA ORF Clone, Mouse, untagged Alternative Names

ADPRT cDNA ORF Clone, Mouse;ARTC1 cDNA ORF Clone, Mouse;Yac-1 cDNA ORF Clone, Mouse

ART1 Background Information

Mono-ADP-ribosyltransferase (ART) 1 belongs to a family of mammalian ectoenzymes that catalyze the transfer of ADP-ribose from NAD+ to a target protein. ART1 is predominantly expressed in skeletal and cardiac muscle. It ADP-ribosylates alpha7-integrin which together with beta1-integrin forms a dimer and binds to laminin, a protein of the extracellular matrix involved in cell adhesion. This posttranslational modification leads to an increased laminin binding affinity. The differentiation-dependent upregulation of ART1 mRNA is induced by the binding of myogenin to an E box and of MEF-2 to an A/T-rich element in the proximal promoter region of the ART1 gene. Colorectal carcinoma is one of the most common cancers world-wide, with high morbidity and mortality rates. Arginine ADP-ribosyltransferase 1(ART1) is an important ecto-ADP-ribose transferase and has been proven to be intimately involved in a number of biological processes. The molecular mechanism for the function of ART1 in colorectal carcinoma and defines a potential therapeutic target for the enhanced treatment of this prominent world-wide disease
Full Name
ADP-ribosyltransferase 1

ART1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ART1 cDNA ORF Clone in Cloning Vector, Rhesus CG90271-G
ART1 cDNA ORF Clone, Rhesus, untagged CG90271-UT
ART1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90271-ACGLN
ART1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90271-ACG
ART1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90271-ACR
ART1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90271-CF
ART1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90271-NF
ART1 cDNA ORF Clone, Rhesus, C-His tag CG90271-CH
ART1 cDNA ORF Clone, Rhesus, N-His tag CG90271-NH
ART1 cDNA ORF Clone, Rhesus, C-HA tag CG90271-CY
ART1 cDNA ORF Clone, Rhesus, N-HA tag CG90271-NY
ART1 cDNA ORF Clone, Rhesus, C-Myc tag CG90271-CM
ART1 cDNA ORF Clone, Rhesus, N-Myc tag CG90271-NM

ART1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ART1 cDNA ORF Clone in Cloning Vector, Rat RG80382-G
ART1 cDNA ORF Clone, Rat, untagged RG80382-UT
ART1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80382-ACGLN
ART1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80382-ACG
ART1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80382-ACR
ART1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80382-CF
ART1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80382-NF
ART1 cDNA ORF Clone, Rat, C-His tag RG80382-CH
ART1 cDNA ORF Clone, Rat, N-His tag RG80382-NH
ART1 cDNA ORF Clone, Rat, C-HA tag RG80382-CY
ART1 cDNA ORF Clone, Rat, N-HA tag RG80382-NY
ART1 cDNA ORF Clone, Rat, C-Myc tag RG80382-CM
ART1 cDNA ORF Clone, Rat, N-Myc tag RG80382-NM
ART1 qPCR Primer Pairs, Rat RP300349

ART1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ART1 cDNA ORF Clone in Cloning Vector, Mouse MG50988-G
ART1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50988-ACGLN
ART1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50988-ACG
ART1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50988-ACR
ART1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50988-CF
ART1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50988-NF
ART1 cDNA ORF Clone, Mouse, C-His tag MG50988-CH
ART1 cDNA ORF Clone, Mouse, N-His tag MG50988-NH
ART1 cDNA ORF Clone, Mouse, C-HA tag MG50988-CY
ART1 cDNA ORF Clone, Mouse, N-HA tag MG50988-NY
ART1 cDNA ORF Clone, Mouse, C-Myc tag MG50988-CM
ART1 cDNA ORF Clone, Mouse, N-Myc tag MG50988-NM
ART1 qPCR Primer Pairs, Mouse MP200954

ART1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ART1 cDNA ORF Clone, Human, untagged HG22286-UT
info info
添加购物车成功! 添加购物车失败!