Artemin cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

Artemin cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Mouse artemin with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Artemin cDNA ORF Clone, Mouse, C-His tag: Alternative Names

neublastin cDNA ORF Clone, Mouse

Artemin Background Information

Artemin (ARTN) is a member of glial cell line-derived neurotrophic factor (GDNF) family of ligands, and its signaling is mediated via a multi-component receptor complex including the glycosylphosphatidylinositol-anchored GDNF family receptors a (GFRa1, GFRa3) and RET receptor tyrosine kinase. The major mechanism of ARTN action is via binding to a non-signaling co-receptor. The major function of ARTN is to drive the molecule to induce migration and axonal projection from sympathetic neurons. It also promotes the survival, proliferation and neurite outgrowth of sympathetic neurons in vitro. ARTN triggers oncogenicity and metastasis by the activation of the AKT signaling pathway. Recent studies have reported that the expression of ARTN in hepatocellular carcinoma is associated with increased tumor size, quick relapse and shorter survival. Furthermore, ARTN promotes drug resistance such as antiestrogens, doxorubicin, fulvestrant, paclitaxel, tamoxifen and trastuzumab. Moreover, ARTN also stimulates the radio-therapeutic resistance. Hypoxia has been reported to regulate the cancer stem cell (CSC) population yet the underlying mechanism is poorly characterized. Artemin (ARTN) is a member of the glial cell derived neurotrophic factor family of ligands, is a hypoxia-responsive factor and is essential for hypoxia-induced CSC expansion in hepatocellular carcinoma (HCC). Clinically, elevated expression of ARTN in HCC was associated with larger tumor size, faster relapse and shorter survival. In vitro, HCC cells with forced expression of ARTN exhibited reduced apoptosis, increased proliferation, epithelial-mesenchymal transition (EMT) and enhanced motility. Additionally, ARTN dramatically increased xenograft tumor size and metastasis in vivo. Moreover, ARTN also enhanced tumorsphere formation and the tumor initiating capacity of HCC cells, consequent to expansion of the CD133+ CSC population. ARTN transcription was directly activated by hypoxia-induced factor-1α (HIF-1α) and hypoxia induced ARTN promoted EMT and increased the CSC population via AKT signaling.
Full Name
artemin
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait