Argininosuccinate lyase cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

Argininosuccinate lyase cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1395 bp
Description
Full length Clone DNA of Mouse argininosuccinate lyase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Argininosuccinate lyase cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

2510006M18Rik cDNA ORF Clone, Mouse

Argininosuccinate lyase Background Information

The recycling of citrulline by argininosuccinate synthase 1 (ASS1) and argininosuccinate lyase (ASL) is crucial to maintain arginine availability and nitric oxide (NO) production. Nitric oxide (NO) plays an established role in numerous physiological and pathological processes, but the specific cellular sources of NO in disease pathogenesis remain unclear, preventing the implementation of NO-related therapy. Argininosuccinate lyase (ASL) is the only enzyme able to produce arginine, the substrate for NO generation by nitric oxide synthase (NOS) isoforms. Induction of endogenous NO production by enterocytes with supplements that upregulate ASL expression and complement its substrates results in improved epithelial integrity and alleviation of colitis and of inflammation-associated colon cancer.
Full Name
argininosuccinate lyase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait