Commande rapide

Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ANGPTL4 Informations sur les produits clonés de cDNA
Taille du ADNc:1233bp
Description du ADNc:Full length Clone DNA of Mus musculus angiopoietin-like 4 with C terminal Myc tag.
Synonyme du gène:Arp4, Bk89, Fiaf, Ng27, Pgar, Hfarp, Pgarg, Pp1158, Angptl4
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50356-ACGCHF270
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50356-ACRCHF270
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50356-CFCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50356-CHCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50356-CMCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50356-CYCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 Gène ADNc clone le vecteur de clonageMG50356-MCHF90
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50356-NFCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50356-NHCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50356-NMCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50356-NYCHF230
Souris ANGPTL4 / angiopoietin-like Protéine 4 expression plasmide de Gène l'ADNc ORF cloneMG50356-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Catalogue : MG50356-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.