CD57 / B3gat1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

CD57 / B3gat1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Mouse beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD57 / B3gat1 cDNA ORF Clone, Mouse, untagged: Alternative Names

0710007K08Rik cDNA ORF Clone, Mouse; AI846286 cDNA ORF Clone, Mouse; GlcAT-P cDNA ORF Clone, Mouse; Glcatp cDNA ORF Clone, Mouse; Hnk1 cDNA ORF Clone, Mouse

CD57 / B3gat1 Background Information

B3GAT1 is the key enzyme during the biosynthesis of the carbohydrate epitope HNK-1, which is present on a number of cell adhesion molecules important in neurodevelopment. Saturating concentrations of rVAR2 inhibited downstream integrin signaling, which was mimicked by knockdown of the core chondroitin sulfate synthesis enzymes β-1,3-glucuronyltransferase 1 (B3GAT1) and chondroitin sulfate N-acetylgalactosaminyltransferase 1 (CSGALNACT1).
Full Name
beta-1,3-glucuronyltransferase 1

CD57 / B3gat1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait