B4GALNT1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52579-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All B4GALNT1 Reagents

CRO Services

Product recommended


All B4GALNT1 Reagents

B4GALNT1 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1602 bp
Description
Full length Clone DNA of Mouse beta-1,4-N-acetyl-galactosaminyl transferase 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B4GALNT1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

4933429D13Rik cDNA ORF Clone, Mouse;Gal-NAc-T cDNA ORF Clone, Mouse;Galgt1 cDNA ORF Clone, Mouse;GalNAc-T cDNA ORF Clone, Mouse;GalNAcT cDNA ORF Clone, Mouse;Ggm-2 cDNA ORF Clone, Mouse;Ggm2 cDNA ORF Clone, Mouse

B4GALNT1 Background Information

BGNT-1.1 in ciliated sensory neuron function and morphogenesis. BGNT-1.1 functions at the trans-Golgi network of sheath cells (glia) to influence dye-filling and cilium length, in a cell non-autonomous manner. Notably, BGNT-1.1 is the orthologue of human B3GNT1/B4GAT1, a glycosyltransferase associated with Walker-Warburg syndrome (WWS). WWS is a multigenic disorder characterised by muscular dystrophy as well as brain and eye anomalies. Dystroglycan is a cell membrane receptor that organizes the basement membrane by binding ligands in the extracellular matrix. Proper glycosylation of the α-dystroglycan (α-DG) subunit is essential for these activities, and lack thereof results in neuromuscular disease. we had known that FKRP, FKTN, TMEM5 and B4GAT1 (formerly known as B3GNT1) localize to the Golgi and contribute to the O-mannosyl post-phosphorylation modification of α-DG. Moreover, we assigned B4GAT1 a function as a xylose β1,4-glucuronyltransferase. Nuclear magnetic resonance studies confirmed that a glucuronic acid β1,4-xylose disaccharide synthesized by B4GAT1 acts as an acceptor primer that can be elongated by LARGE with the ligand-binding heteropolysaccharide. Recent studies demonstrated that mutations in B3GNT1, an enzyme proposed to be involved in poly-N-acetyllactosamine synthesis, were causal for congenital muscular dystrophy with hypoglycosylation of α-dystroglycan (secondary dystroglycanopathies). Since defects in the O-mannosylation protein glycosylation pathway are primarily responsible for dystroglycanopathies and with no established O-mannose initiated structures containing a β3 linked GlcNAc known, we biochemically interrogated this human enzyme.
Full Name
beta-1,4-N-acetyl-galactosaminyl transferase 1
info info
添加购物车成功! 添加购物车失败!