After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris CD80/B7-1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CD80 Informations sur les produits clonés de cDNA
Taille du ADNc:897bp
Description du ADNc:Full length Clone DNA of Mus musculus CD80 molecule with C terminal His tag.
Synonyme du gène:CD80, B7-1, LAB7, CD28LG, CD28LG1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.

  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.