Commande rapide

Souris Betacellulin / BTC expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse BTC Informations sur les produits clonés de cDNA
Taille du ADNc:534bp
Description du ADNc:Full length Clone DNA of Mus musculus betacellulin, epidermal growth factor family member with C terminal Myc tag.
Synonyme du gène:BTC
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Betacellulin(BTC) is a member of the epidermal growth factor (EGF) family. These soluble proteins are ligands for one or more of the four receptor tyrosine kinases encoded by the ErbB gene family (ErbB-1/epidermal growth factor receptor (EGFR), neu/ErbB-2/HER2, ErbB-3/HER3 and ErbB-4/HER4). Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from a larger transmembrane precursor by proteolytic cleavage. This protein is a ligand for the EGF receptor. BTC is a polymer of about 62-111 amino acid residues. Secondary Structure: 6% helical (1 helices; 3 residues)36% beta sheet (5 strands; 18 residues). BTC was originally identified as a growth-promoting factor in mouse pancreatic β-cell carcinoma cell line and has since been identified in humans. It plays a role in the growth and development of the neonate and/or mammary gland function. Betacellulin is a potent mitogen for retinal pigment epithelial cells and vascular smooth muscle cells.

  • Shing Y, et al. (1993) Betacellulin: a mitogen from pancreatic beta cell tumors. Science . 259(5101): 1604-7.
  • Riese DJ, et al. (1996) Betacellulin activates the epidermal growth factor receptor and erbB-4, and induces cellular response patterns distinct from those stimulated by epidermal growth factor or neuregulin-beta. Oncogene. 12(2): 345-53.
  • Bastian SE, et al. (2001) Measurement of betacellulin levels in bovine serum, colostrum and milk. J Endocrinol . 168: 203-12.
  • Size / Price
    Catalogue : MG50340-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.