C030006K11RIK cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

C030006K11RIK cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA C030006K11 gene.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C030006K11RIK cDNA ORF Clone, Mouse, untagged: Alternative Names

1110033I13Rik cDNA ORF Clone, Mouse

C030006K11RIK Background Information

Full Name
RIKEN cDNA C030006K11 gene
Add to Cart Successfully Add to Cart Failed