Commande rapide

Text Size:AAA

Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CA4 Informations sur les produits clonés de cDNA
Taille du ADNc:918bp
Description du ADNc:Full length Clone DNA of Mus musculus carbonic anhydrase 4 with C terminal Myc tag.
Synonyme du gène:Ca4, AW456718, Car4
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50350-ACGCHF270
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50350-ACRCHF270
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50350-CFCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50350-CHCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50350-CHCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50350-CMCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50350-CYCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 Gène ADNc clone le vecteur de clonageMG50350-MCHF90
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50350-NFCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50350-NHCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50350-NMCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50350-NYCHF234
Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF cloneMG50350-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase IV (CAIV) is a membrane-associated enzyme anchored to plasma membrane surfaces by a phosphatidylinositol glycan linkage. CAIV is a high-activity isozyme in CO2 hydration comparable to that of CAII. Furthermore, CAIV is more active in HCO3- dehydration than is CAII. However, the esterase activity of CAIV is decreased 150-fold compared to CAII.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Baird TT, et al. (1997) Catalysis and Inhibition of Human Carbonic Anhydrase IV. Biochemistry. 36 (9): 2669-78.
  • Size / Price
    Catalogue : MG50350-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.