Commande rapide

Souris Carbonic Anhydrase IV / Car4 / CA4 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris CA4 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_007607.2
    Taille du ADNc:918bp
    Description du ADNc:Full length Clone DNA of Mus musculus carbonic anhydrase 4 with C terminal Myc tag.
    Synonyme du gène:Ca4, AW456718, Car4
    Espèces:Mouse
    Vecteur:pCMV3-C-Myc
    Plasmid:
    Site de restriction:
    Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CA4 qPCR primers for gene expression analysis, MP200371 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Fond

    The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase IV (CAIV) is a membrane-associated enzyme anchored to plasma membrane surfaces by a phosphatidylinositol glycan linkage. CAIV is a high-activity isozyme in CO2 hydration comparable to that of CAII. Furthermore, CAIV is more active in HCO3- dehydration than is CAII. However, the esterase activity of CAIV is decreased 150-fold compared to CAII.

    Références
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Baird TT, et al. (1997) Catalysis and Inhibition of Human Carbonic Anhydrase IV. Biochemistry. 36 (9): 2669-78.
  • Size / Price
    Catalogue : MG50350-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »