Commande rapide

Text Size:AAA

Souris CADM4/IGSF4C/NECL-4 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CADM4 Informations sur les produits clonés de cDNA
Taille du ADNc:1167bp
Description du ADNc:Full length Clone DNA of Mus musculus cell adhesion molecule 4 with C terminal HA tag.
Synonyme du gène:Tsll2, Igdf4c, Igsf4c, Cadm4
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily molecule showing significant homology with a lung tumor suppressor, TSLC1. CADM4/IGSF4C/NECL-4 protein is mainly expressed in the kidney, bladder, and prostate in addition to the brain. Experiments have reported the biological significance of CADM4/IGSF4C/NECL-4 in the urinary tissues. An immunohistochemical study reveals that CADM4 is expressed at the cell-cell attachment sites in the renal tubules, the transitional epithelia of the bladder, and the glandular epithelia of the prostate. IGSF4-immunoreactivity (IR) was observed diffusely in the telencephalic wall, whereas it became rather confined to the subplate, the cortical plate and the subventricular zone as the development proceeded. IGSF4-IR gradually decreased after birth and disappeared in adulthood. IGSF4 remained at low levels throughout embryonic stage, whereas it increased after birth. These spatiotemporal patterns of the expression suggest that IGSF4 plays crucial roles in the development of both telencephalon and cerebellum. CADM4/IGSF4C/NECL-4 is ectopically expressed in adult T-cell leukemia (ATL) cells, providing not only a diagnostic marker for ATL, but also a possible therapeutic target against its invasion. The distinct roles of CADM4/IGSF4C/NECL-4 in the oncogenesis of carcinomas and ATL could be due to tissue-specific differences in the downstream cascades, and is a novel concept with respect to cell adhesion in human oncogenesis.

  • Williams YN, et al. (2006) Cell adhesion and prostate tumor-suppressor activity of TSLL2/IGSF4C, an immunoglobulin superfamily molecule homologous to TSLC1/IGSF4. Oncogene. 25(10): 1446-53.
  • Ohta Y, et al. (2005) Spatiotemporal patterns of expression of IGSF4 in developing mouse nervous system. Brain Res Dev Brain Res. 156(1): 23-31.
  • Shingai T, et al. (2003) Implications of nectin-like molecule-2 /IGSF4 /RA175 /SgIGSF /TSLC1 /SynCAM1 in cell-cell adhesion and transmembrane protein localization in epithelial cells. J Biol Chem. 278(37): 35421-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.