CAMKI cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

CAMKI cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase I.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CAMKI cDNA ORF Clone, Mouse, untagged: Alternative Names

AI505105 cDNA ORF Clone, Mouse; CaMKIalpha cDNA ORF Clone, Mouse; D6Ertd263e cDNA ORF Clone, Mouse

CAMKI Background Information

Calcium/calmodulin-dependent protein kinase orCaM kinases are serine/threonine-specific protein kinasesthat are primarily regulated by the Calcium/calmodulin complex. These kinases show a memory effect on activation. CaM kinases activity can outlast the intracellular calcium transient that is needed to activate it. Inneurons, this property is important for the induction of synaptic plasticity. Pharmacological inhibition of CaM kinases II blocks the induction oflong-term potentiation. Upon activation, CaM kinases II phosphorylates postsynaptic glutamate receptors and changes the electrical properties of the synapse. Calcium/calmodulin-dependent protein kinase type 1D, also known as CaM kinase I delta, CaM kinase ID, CaMKI-like protein kinase, CKLiK and CAMK1D, is a member of theprotein kinase superfamily and CaMK subfamily. It contains oneprotein kinase domain. CAMK1D is broadly expressed. It is highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. Engineered overexpression of CAMK1D in non-tumorigenic breast epithelial cells led to increased cell proliferation, and molecular and phenotypic alterations indicative of epithelial-mesenchymal transition (EMT), including loss of cell-cell adhesions and increased cell migration and invasion. CAMK1D is a potential therapeutic target with particular relevance to clinically unfavorable basal-like tumors.
Full Name
calcium/calmodulin-dependent protein kinase I
References
  • Lisman, JE. et al., 1985, Proc Natl Acad Sci USA. 82 (9): 3055-7.
  • Bergamaschi, A. et al., 2008, Mol Oncol. 2 (4): 327-39.
  • White RB. et al., 2008, Physiological genomics, 33 (1): 41-9.
  • Schleinitz, D. et al., 2010, Horm Metab Res. 42 (1): 14-22.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait