CCL28 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50107-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CCL28 Reagents
CRO Services
Product recommended

All CCL28 Reagents
CCL28 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
393 bp
Description
Full length Clone DNA of Mouse chemokine (C-C motif) ligand 28 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL28 cDNA ORF Clone, Mouse, N-His tag Alternative Names
CCK1 cDNA ORF Clone, Mouse;MEC cDNA ORF Clone, Mouse;Scya28 cDNA ORF Clone, Mouse
CCL28 Background Information
Full Name
chemokine (C-C motif) ligand 28

CCL28 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCL28 cDNA ORF Clone in Cloning Vector, Mouse MG50107-M
CCL28 cDNA ORF Clone, Mouse, untagged MG50107-UT
CCL28 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50107-ACG
CCL28 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50107-ACGLN
CCL28 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50107-ACR
CCL28 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50107-CF
CCL28 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50107-NF
CCL28 cDNA ORF Clone, Mouse, C-His tag MG50107-CH
CCL28 cDNA ORF Clone, Mouse, C-HA tag MG50107-CY
CCL28 cDNA ORF Clone, Mouse, N-HA tag MG50107-NY
CCL28 cDNA ORF Clone, Mouse, C-Myc tag MG50107-CM
CCL28 cDNA ORF Clone, Mouse, N-Myc tag MG50107-NM
CCL28 qPCR Primer Pairs, Mouse MP200137

CCL28 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCL28 cDNA ORF Clone in Cloning Vector, Human HG10618-M
CCL28 cDNA ORF Clone, Human, untagged HG10618-UT
CCL28 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10618-ACGLN
CCL28 cDNA ORF Clone, Human, C-GFPSpark® tag HG10618-ACG
CCL28 cDNA ORF Clone, Human, C-OFPSpark® tag HG10618-ACR
CCL28 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10618-CF
CCL28 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10618-NF
CCL28 cDNA ORF Clone, Human, C-His tag HG10618-CH
CCL28 cDNA ORF Clone, Human, N-His tag HG10618-NH
CCL28 cDNA ORF Clone, Human, C-HA tag HG10618-CY
CCL28 cDNA ORF Clone, Human, N-HA tag HG10618-NY
CCL28 cDNA ORF Clone, Human, C-Myc tag HG10618-CM
CCL28 cDNA ORF Clone, Human, N-Myc tag HG10618-NM
CCL28 qPCR Primer Pairs, Human HP100599
info info
添加购物车成功! 添加购物车失败!