Commande rapide

Text Size:AAA

Souris CCL3/Mip1a expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CCL3 Informations sur les produits clonés de cDNA
Taille du ADNc:279bp
Description du ADNc:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 3 with C terminal HA tag.
Synonyme du gène:RP23-320E6.7, AI323804, G0S19-1, LD78alpha, MIP-1alpha, MIP1-(a), MIP1-alpha, Mip1a, Scya3
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

CCL3 is a cytokine belonging to the CC chemokine family. Chemokines are a family of structurally related leukocyte chemoattractant cytokines that play a central role during immunoregulatory and inflammation processes. All chemokines contain four conserved cysteines linked by disulfide bonds, and two major subfamilies, namely CXC and CC, are defined on the basis of the first two cysteines which are separated by one amino acid or are adjacent. CCL3 is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes.

  • Zhao RY, et al. (2005) Viral infections and cell cycle G2/M regulation. Cell Res. 15(3):143-9. Joseph AM, et al. (2005) Nef: "necessary and enforcing factor" in HIV infection. Curr HIV Res. 3(1):87-94. Muthumani K, et al. (2004) HIV-1 Vpr and anti-inflammatory activity. DNA Cell Biol. 23(4): 239-47.
  • Size / Price
    Catalogue : MG51114-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.