Cyclin B2 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

Cyclin B2 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1197 bp
Description
Full length Clone DNA of Mouse cyclin B2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cyclin B2 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

CycB2 cDNA ORF Clone, Mouse

Cyclin B2 Background Information

Cyclin B2 (CCNB2), a member of cyclin family proteins, serves a key role in progression of G2/M transition. CCNB2 protein is associated with clinical progression and poor prognosis in NSCLC. Cyclin B2 (CCNB2), a member of the cyclin protein family, has been found to be up-regulated in human cancers. Detection of serum circulating CCNB2 mRNA may have potential clinical applications in screening and monitoring of metastasis and therapeutic treatments.
Full Name
cyclin B2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait