CCR6 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

CCR6 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1104 bp
Description
Full length Clone DNA of Mouse chemokine (C-C motif) receptor 6 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCR6 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

CC-CKR-6 cDNA ORF Clone, Mouse; CCR-6 cDNA ORF Clone, Mouse; Cmkbr6 cDNA ORF Clone, Mouse; KY411 cDNA ORF Clone, Mouse

CCR6 Background Information

Chemokine receptors CCR6 and CCR7 have been reported to play important roles in T cell migration and organ-specific metastasis of various tumors. The expression levels of CCR6 and CCR7 in tumor tissues in patients with lymph node metastases than those without lymph node metastases. CCR6 and CCR7 expressions were also detected in metastatic lymph nodes. CCR6(+) subset of CD4(+) regulatory T cells, a newly characterized subset of Tregs, has been reported to contribute to local immune inhibition. There is a new subset of tumor-resident Tregs, CCR6(+) Tregs, may be dominantly responsible for the immunosuppression in tumor immunity and a potential predictor of the poor prognosis of breast cancer.
Full Name
chemokine (C-C motif) receptor 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait