CCR7/CD197 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50873-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CCR7/CD197 Reagents

CRO Services

Product recommended


All CCR7/CD197 Reagents

CCR7/CD197 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1137 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 327 A/G and 1038 C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse chemokine (C-C motif) receptor 7 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.19kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCR7/CD197 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCR7/CD197 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images

Mouse CCR7 Gene Expression validated Image 2248
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609

CCR7/CD197 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

CC-CKR-7 cDNA ORF Clone, Mouse;CCR-7 cDNA ORF Clone, Mouse;CD197 cDNA ORF Clone, Mouse;Cdw197 cDNA ORF Clone, Mouse;Cmkbr7 cDNA ORF Clone, Mouse;EBI1 cDNA ORF Clone, Mouse;Ebi1h cDNA ORF Clone, Mouse

CCR7/CD197 Background Information

Full Name
chemokine (C-C motif) receptor 7

CCR7/CD197 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Rhesus CG90241-G
CCR7/CD197 cDNA ORF Clone, Rhesus, untagged CG90241-UT
CCR7/CD197 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90241-ACG
CCR7/CD197 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90241-ACGLN
CCR7/CD197 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90241-ACR
CCR7/CD197 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90241-CF
CCR7/CD197 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90241-NF
CCR7/CD197 cDNA ORF Clone, Rhesus, C-His tag CG90241-CH
CCR7/CD197 cDNA ORF Clone, Rhesus, N-His tag CG90241-NH
CCR7/CD197 cDNA ORF Clone, Rhesus, C-HA tag CG90241-CY
CCR7/CD197 cDNA ORF Clone, Rhesus, N-HA tag CG90241-NY
CCR7/CD197 cDNA ORF Clone, Rhesus, C-Myc tag CG90241-CM
CCR7/CD197 cDNA ORF Clone, Rhesus, N-Myc tag CG90241-NM

CCR7/CD197 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Rat RG80360-G
CCR7/CD197 cDNA ORF Clone, Rat, untagged RG80360-UT
CCR7/CD197 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80360-ACG
CCR7/CD197 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80360-ACGLN
CCR7/CD197 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80360-ACR
CCR7/CD197 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80360-CF
CCR7/CD197 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80360-NF
CCR7/CD197 cDNA ORF Clone, Rat, C-His tag RG80360-CH
CCR7/CD197 cDNA ORF Clone, Rat, N-His tag RG80360-NH
CCR7/CD197 cDNA ORF Clone, Rat, C-HA tag RG80360-CY
CCR7/CD197 cDNA ORF Clone, Rat, N-HA tag RG80360-NY
CCR7/CD197 cDNA ORF Clone, Rat, C-Myc tag RG80360-CM
CCR7/CD197 cDNA ORF Clone, Rat, N-Myc tag RG80360-NM
CCR7/CD197 qPCR Primer Pairs, Rat RP300330

CCR7/CD197 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Mouse MG50873-G
CCR7/CD197 cDNA ORF Clone, Mouse, untagged MG50873-UT
CCR7/CD197 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50873-ACGLN
CCR7/CD197 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50873-ACG
CCR7/CD197 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50873-ACR
CCR7/CD197 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50873-NF
CCR7/CD197 cDNA ORF Clone, Mouse, C-His tag MG50873-CH
CCR7/CD197 cDNA ORF Clone, Mouse, N-His tag MG50873-NH
CCR7/CD197 cDNA ORF Clone, Mouse, C-HA tag MG50873-CY
CCR7/CD197 cDNA ORF Clone, Mouse, N-HA tag MG50873-NY
CCR7/CD197 cDNA ORF Clone, Mouse, C-Myc tag MG50873-CM
CCR7/CD197 cDNA ORF Clone, Mouse, N-Myc tag MG50873-NM
CCR7/CD197 qPCR Primer Pairs, Mouse MP200844

CCR7/CD197 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCR7/CD197 cDNA ORF Clone in Cloning Vector, Human HG12112-G
CCR7/CD197 cDNA ORF Clone, Human, untagged HG12112-UT
CCR7/CD197 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12112-ACGLN
CCR7/CD197 cDNA ORF Clone, Human, C-GFPSpark® tag HG12112-ACG
CCR7/CD197 cDNA ORF Clone, Human, C-OFPSpark® tag HG12112-ACR
CCR7/CD197 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12112-CF
CCR7/CD197 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12112-NF
CCR7/CD197 cDNA ORF Clone, Human, C-His tag HG12112-CH
CCR7/CD197 cDNA ORF Clone, Human, N-His tag HG12112-NH
CCR7/CD197 cDNA ORF Clone, Human, C-HA tag HG12112-CY
CCR7/CD197 cDNA ORF Clone, Human, N-HA tag HG12112-NY
CCR7/CD197 cDNA ORF Clone, Human, C-Myc tag HG12112-CM
CCR7/CD197 cDNA ORF Clone, Human, N-Myc tag HG12112-NM
CCR7/CD197 qPCR Primer Pairs, Human HP101639
info info
添加购物车成功! 添加购物车失败!