Commande rapide

Souris ICAM-1/CD54 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ICAM1 Informations sur les produits clonés de cDNA
Taille du ADNc:1614bp
Description du ADNc:Full length Clone DNA of Mus musculus intercellular adhesion molecule 1 with N terminal Flag tag.
Synonyme du gène:CD54, Ly-47, Icam-1, MALA-2, MGC6195, Icam1
Site de restriction:KpnI + XbaI (6kb + 1.62kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ICAM1 Gene Plasmid Map
Mouse CD54 / ICAM1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.
  • Size / Price
    Catalogue : MG50440-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Mouse CD54 / ICAM1 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.