After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris CD59a / Protectin expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CD59A Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_007652.4
Taille du ADNc:372bp
Description du ADNc:Full length Clone DNA of Mus musculus CD59 antigen with N terminal His tag.
Synonyme du gène:Cd59, AA987121, protectin, Cd59a
Espèces:Mouse
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

Protectin, a complement regulatory protein, also known as CD59, or MIRL (membrane inhibitor of reactive lysis) is a small protein that inhibits the complement membrane attack complex by binding C5b678 and preventing C9 from binding and polymerizing. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxy-terminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins.It was found that the CD59/Protectin antigen is a small protein sometimes associated with larger components (45 and 80 kD) in urine. CD59/Protectin antigen was released from the surface of transfected COS cells by phosphatidylinositol-specific phospholipase C, demonstrating that it is attached to the cell membrane by means of a glycolipid anchor; it is therefore likely to be absent from the surface of affected erythrocytes in the disease paroxysmal nocturnal hemoglobinuria.

Références
  • Huang Y, et al. (2006) Defining the CD59-C9 binding interaction. J Biol Chem. 281 (37): 27398-404.
  • Sawada R, et al. (1990) Isolation and expression of the full-length cDNA encoding CD59 antigen of human lymphocytes. DNA Cell Biol. 9(3): 213-20.
  • Philbrick WM, et al. (1990) The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility. Eur J Immunol. 20(1): 87-92.
  • Size / Price
    Catalogue : MG50724-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »