Commande rapide

Text Size:AAA

Souris CD59a / Protectin expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris CD59A Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_007652.4
    Taille du ADNc:372bp
    Description du ADNc:Full length Clone DNA of Mus musculus CD59 antigen with N terminal His tag.
    Synonyme du gène:Cd59, AA987121, protectin, Cd59a
    Espèces:Mouse
    Vecteur:pCMV3-SP-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD59a qPCR primers for gene expression analysis, MP200699 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Fond

    Protectin, a complement regulatory protein, also known as CD59, or MIRL (membrane inhibitor of reactive lysis) is a small protein that inhibits the complement membrane attack complex by binding C5b678 and preventing C9 from binding and polymerizing. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxy-terminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins.It was found that the CD59/Protectin antigen is a small protein sometimes associated with larger components (45 and 80 kD) in urine. CD59/Protectin antigen was released from the surface of transfected COS cells by phosphatidylinositol-specific phospholipase C, demonstrating that it is attached to the cell membrane by means of a glycolipid anchor; it is therefore likely to be absent from the surface of affected erythrocytes in the disease paroxysmal nocturnal hemoglobinuria.

    Références
  • Huang Y, et al. (2006) Defining the CD59-C9 binding interaction. J Biol Chem. 281 (37): 27398-404.
  • Sawada R, et al. (1990) Isolation and expression of the full-length cDNA encoding CD59 antigen of human lymphocytes. DNA Cell Biol. 9(3): 213-20.
  • Philbrick WM, et al. (1990) The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility. Eur J Immunol. 20(1): 87-92.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »