After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris CD74 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse CD74 Informations sur les produits clonés de cDNA
Taille du ADNc:840bp
Description du ADNc:Full length Clone DNA of Mus musculus CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) with N terminal His tag.
Synonyme du gène:Ii, CLIP, DHLAG, HLADG, Ia-GAMMA, Cd74
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD74, also known as HLA class2 histocompatibility antigen gamma chain and HLA-DR antigens-associated invariant chain, is a polypeptide involved in the formation and transport of MHC class2 protein. CD74 is expressed by B cells, macrophages, and Reed-Sternberg cells. When MHC class 2 protein was in the rough ER, its peptide-binding cleft was blocked by CD74 to prevent it from interacting with the endogenous peptides. CD74 also serves to facilitate MHC class2's export from ER.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Moynes R, et al. (1997) A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 79 (11): 2115-24.
  • Gabrielle FA, et al. (2008) Regulation of dendritic cell migration by CD74, the MHC class 2-associated invariant chain. Science. 322 (5908): 1705-10.
  • Leng L, et al. (2003) MIF signal transduction initiated by binding to CD74. JEM.197 (11): 1467-76.
  • Size / Price
    Catalogue : MG50738-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.